To search by using sequence similarity searching, users need to put DNA sequences in the fasta format that look like these following examples.

>AU056052

TATAATATTTCCATACATATAATCCACTTACTCCATCGAACANTACCTCTGTTACCTCATGGTTACTTCC CATGANCCCATCATCAACNCCAACATTCATCACACTTTNCTGCGTTAGAGCAGGTNCAATGGCAGGCTAT AAGCCAGCTACAAACATATTTTACGAAGATAAATCAAGAGAGAGAAGAGCAACGGGCTACAGATTTGTAG CCAGCTGTAGCACGGACTCCAAGACGCAGTGTGTCTATGACAGGTGGGACTAGATATTAATAGTGTAGTA TGTAACTATTGTATGAATGGGCTATTAGATTGACTATAGATGAATTGGAGCTAGTAGTTGGCTATACTAT TGAACTTGCTCTTATATAGCAACAGGTACAGTATATGAATTAATTATCTCACAACTATTGGAAAGTTGGC GCCAGAAAACTGAGGGAGCACTGAAACAAATTTGTTGTGCGGAAACATTTATATTAAAAAAAACATATAT TATGGACATATGTGATTAAAAAAAAAAAAAAAAAAAA

>D15147

CGCAGATGAAATCGTTACAACTCAAACCTACGTGGAGATACCAGATGCGCTTGATGAGGGGTTCAGTATA TCTCCATTTGGGAACAATGCTCCTGCTACTGAGGTGGATAAATCACTCTTCAATGTAAAAGTGATCACAG GCCCAAAGAAATCTACAGAGCAAAAGCTTTCAAATGGGTCTCCACAAAATGTAGTGCACCTGGACATATT CAAAGGAACAAAAGGAGGGGATGTGTGTGAGGGTGAAGGGATGGTGAAAGATTGCCATCCATTCAGAAAG GGGAGGGATGAAATATCTCTAAAACCCATAGAAGTGAGGAAGAAGTTNGG

>D22419 
 GTGATCTGGCAAGATGGGACAAAAGAATGTGGAGCAAGCTCAACATTGCTCATCCCGATCCACAGTCCAA    
ATGACCATGAATTCTTTCCGGAGCAGTATGTCGTGGACAAGGTTGGTAATGATGTTGATGATTCTNCTGA 
AACAAAACGTGTGGGTCTTGTTAGAAGTGTTAATGCAAAGGACCGAACTGCATCTGTATCATGGTTTAAG
CCTTCATTACACCCAGAGGAGCCCAGAGA